Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 3275832
End position: 3275855
Length: 24

DNA sequence
>NC_009348, from 3275832 to 3275855 (24 bp); Aeromonas salmonicida subsp. salmonicida A449 TCGAGCTCGAACTCGCGCTCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3274515-3277007	Sequence	ASA_3040 thrA bifunctional aspartokinase I/homeserine dehydrogenase I (Protein is coded in complementary strand; from 3277007 to 3274515)