Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 3567534
End position: 3567581
Length: 48

DNA sequence
>NC_009348, from 3567534 to 3567581 (48 bp); Aeromonas salmonicida subsp. salmonicida A449 TGGTCATGATCGTGATCGTGATCGTGGTCATGGTCGTGACCATGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3567474-3568058	Sequence	ASA_3299 slyD FKBP-type peptidyl-prolyl cis-trans isomerase slyD (Protein is coded in complementary strand; from 3568058 to 3567474)