Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 3768667
End position: 3768693
Length: 27

DNA sequence
>NC_009348, from 3768667 to 3768693 (27 bp); Aeromonas salmonicida subsp. salmonicida A449 GTTGTTGGCTTTGTTGGCTTTGTTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3767552-3769771	Sequence	ASA_3478 relA GTP pyrophosphokinase (Protein is coded in complementary strand; from 3769771 to 3767552)