Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 3788406
End position: 3788432
Length: 27

DNA sequence
>NC_009348, from 3788406 to 3788432 (27 bp); Aeromonas salmonicida subsp. salmonicida A449 CCAGCTTGACCAGCTTGACCAGCTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3788216-3789115	Sequence	ASA_3497 - LysR family transcriptional regulator (Protein is coded in complementary strand; from 3789115 to 3788216)