Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 4630813
End position: 4630836
Length: 24

DNA sequence
>NC_009348, from 4630813 to 4630836 (24 bp); Aeromonas salmonicida subsp. salmonicida A449 GCCTTGGCCTTGTCCTTGGGCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4630048-4631589	Sequence	ASA_4330 - transposase subunit 1 (Protein is coded in complementary strand; from 4631589 to 4630048)