Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 4653926
End position: 4653949
Length: 24

DNA sequence
>NC_009348, from 4653926 to 4653949 (24 bp); Aeromonas salmonicida subsp. salmonicida A449 GCAGACGGGCAAACGGGCCGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4653553-4654914	Sequence	ASA_4348 glmU UDP-N-acetylglucosamine pyrophosphorylase (Protein is coded in complementary strand; from 4654914 to 4653553)