Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 645995
End position: 646018
Length: 24

DNA sequence
>NC_009348, from 645995 to 646018 (24 bp); Aeromonas salmonicida subsp. salmonicida A449 ATGGTCATGGTCATGGTCATGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 643833-646256	Sequence	ASA_0629 zntA zinc/cadmium/mercury/lead-transporting ATPase (Protein is coded in complementary strand; from 646256 to 643833)