Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 881424
End position: 881447
Length: 24

DNA sequence
>NC_009348, from 881424 to 881447 (24 bp); Aeromonas salmonicida subsp. salmonicida A449 ATGCCGATGCCAAAGCCGATCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 880710-882923	Sequence	ASA_0849 prtV immune inhibitor A, metal-dependent protease (Protein is coded in complementary strand; from 882923 to 880710)