Sequence retrieval

Genome: Enterobacter sp. 638
Start position: 1952069
End position: 1952098
Length: 30

DNA sequence
>NC_009436, from 1952069 to 1952098 (30 bp); Enterobacter sp. 638 CTCGCTATCGCTATCGCTATCGCTGTCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1952064-1952738	Sequence	Ent638_1794 - ribonuclease T (Protein is coded in complementary strand; from 1952738 to 1952064)