Sequence retrieval

Genome: Enterobacter sp. 638
Start position: 2816395
End position: 2816430
Length: 36

DNA sequence
>NC_009436, from 2816395 to 2816430 (36 bp); Enterobacter sp. 638 TATTCTCTGTAGTACTCTCTGTTGTATTCTCTGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2815974-2816894	Sequence	Ent638_2616 - hypothetical protein (Protein is coded in complementary strand; from 2816894 to 2815974)