Sequence retrieval

Genome: Enterobacter sp. 638
Start position: 3030486
End position: 3030530
Length: 45

DNA sequence
>NC_009436, from 3030486 to 3030530 (45 bp); Enterobacter sp. 638 CTTCATCGGAATCTGCTTCTTCAGAATCAGCTTCATCGGTCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3030461-3033127	Sequence	Ent638_2799 - DNA gyrase subunit A (Protein is coded in complementary strand; from 3033127 to 3030461)