Sequence retrieval

Genome: Enterobacter sp. 638
Start position: 3336436
End position: 3336480
Length: 45

DNA sequence
>NC_009436, from 3336436 to 3336480 (45 bp); Enterobacter sp. 638 GCGGTCGTCGCGTTTGCGATCGTCACGCTTACGGTCATCACGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3335570-3336667	Sequence	Ent638_3066 - methyltransferase (Protein is coded in complementary strand; from 3336667 to 3335570)