Sequence retrieval

Genome: Enterobacter sp. 638
Start position: 3824040
End position: 3824087
Length: 48

DNA sequence
>NC_009436, from 3824040 to 3824087 (48 bp); Enterobacter sp. 638 CTTAGCTACTTAGCTACTTAGCTACTTAGCTACTTAGCTACTTAGCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3822870-3824045	Sequence	Ent638_3523 - molecular chaperone DnaJ
ORF... 3824086-3824850	Sequence	Ent638_3524 - FAD-binding 9, siderophore-interacting domain-containing protein (Protein is coded in complementary strand; from 3824850 to 3824086)