Sequence retrieval

Genome: Enterobacter sp. 638
Start position: 3901323
End position: 3901349
Length: 27

DNA sequence
>NC_009436, from 3901323 to 3901349 (27 bp); Enterobacter sp. 638 CCAGCAGCGCCAGCAGCGCCAGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3900828-3902795	Sequence	Ent638_3599 - ATP-dependent RNA helicase DeaD (Protein is coded in complementary strand; from 3902795 to 3900828)