Sequence retrieval

Genome: Enterobacter sp. 638
Start position: 3926216
End position: 3926242
Length: 27

DNA sequence
>NC_009436, from 3926216 to 3926242 (27 bp); Enterobacter sp. 638 ACATCACCGCCATCACCGCCATCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3925172-3926350	Sequence	Ent638_3619 obgE GTPase ObgE (Protein is coded in complementary strand; from 3926350 to 3925172)