Sequence retrieval

Genome: Enterobacter sp. 638
Start position: 4266357
End position: 4266386
Length: 30

DNA sequence
>NC_009436, from 4266357 to 4266386 (30 bp); Enterobacter sp. 638 CAGGTGCAGGTGCAGGTGCAGGTGCAGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4266209-4266733	Sequence	Ent638_3942 - hypothetical protein (Protein is coded in complementary strand; from 4266733 to 4266209)