Sequence retrieval

Genome: Synechococcus sp. RCC307
Start position: 1100472
End position: 1100495
Length: 24

DNA sequence
>NC_009482, from 1100472 to 1100495 (24 bp); Synechococcus sp. RCC307 GGTGGTGGTGATCGTGGTGGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1100189-1101238	Sequence	SynRCC307_1243 - G3E family GTPase/cobalamin synthesis family protein (Protein is coded in complementary strand; from 1101238 to 1100189)