Sequence retrieval

Genome: Synechococcus sp. RCC307
Start position: 1171206
End position: 1171229
Length: 24

DNA sequence
>NC_009482, from 1171206 to 1171229 (24 bp); Synechococcus sp. RCC307 GCAACAGCACCAGCATCAACAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1170818-1171342	Sequence	SynRCC307_1321 - hypothetical protein (Protein is coded in complementary strand; from 1171342 to 1170818)