Sequence retrieval

Genome: Synechococcus sp. RCC307
Start position: 1294317
End position: 1294343
Length: 27

DNA sequence
>NC_009482, from 1294317 to 1294343 (27 bp); Synechococcus sp. RCC307 GGCAGCAGCGCCAGCAGCGGCAACAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1292847-1294382	Sequence	SynRCC307_1455 phnC ABC-type phosphate/phosphonate transport system permease (Protein is coded in complementary strand; from 1294382 to 1292847)