Sequence retrieval

Genome: Synechococcus sp. RCC307
Start position: 1393421
End position: 1393444
Length: 24

DNA sequence
>NC_009482, from 1393421 to 1393444 (24 bp); Synechococcus sp. RCC307 GCAGCAGCAACAGCAGCTGGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1392679-1393446	Sequence	SynRCC307_1577 - hypothetical protein (Protein is coded in complementary strand; from 1393446 to 1392679)