Sequence retrieval

Genome: Synechococcus sp. RCC307
Start position: 1458370
End position: 1458393
Length: 24

DNA sequence
>NC_009482, from 1458370 to 1458393 (24 bp); Synechococcus sp. RCC307 CACCACCACCATCAGCACCAACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1458041-1459309	Sequence	SynRCC307_1667 - putative Na+/H+ antiporter (Protein is coded in complementary strand; from 1459309 to 1458041)