Sequence retrieval

Genome: Synechococcus sp. RCC307
Start position: 1465602
End position: 1465631
Length: 30

DNA sequence
>NC_009482, from 1465602 to 1465631 (30 bp); Synechococcus sp. RCC307 GCCAGCGACGGCCAGCGGCCGCCACCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1464524-1465855	Sequence	SynRCC307_1673 - SNF family sodium-dependent transporter (Protein is coded in complementary strand; from 1465855 to 1464524)