Sequence retrieval

Genome: Synechococcus sp. RCC307
Start position: 1508808
End position: 1508831
Length: 24

DNA sequence
>NC_009482, from 1508808 to 1508831 (24 bp); Synechococcus sp. RCC307 GGTGTCGGTGTTGGGGTCGGTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1508767-1509048	Sequence	SynRCC307_1723 - hypothetical protein (Protein is coded in complementary strand; from 1509048 to 1508767)