Sequence retrieval

Genome: Synechococcus sp. RCC307
Start position: 290927
End position: 290950
Length: 24

DNA sequence
>NC_009482, from 290927 to 290950 (24 bp); Synechococcus sp. RCC307 CTGCAGCTCCAGCTGCGGCCGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 290667-291014	Sequence	SynRCC307_0294 - hypothetical protein (Protein is coded in complementary strand; from 291014 to 290667)