Sequence retrieval

Genome: Psychrobacter sp. PRwf-1
Start position: 1198435
End position: 1198461
Length: 27

DNA sequence
>NC_009524, from 1198435 to 1198461 (27 bp); Psychrobacter sp. PRwf-1 CTTAGATAACTTAGATAACTTAGATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1197885-1198679	Sequence	PsycPRwf_1007 - 2Fe-2S iron-sulfur cluster binding domain-containing protein