Sequence retrieval

Genome: Psychrobacter sp. PRwf-1
Start position: 1287368
End position: 1287403
Length: 36

DNA sequence
>NC_009524, from 1287368 to 1287403 (36 bp); Psychrobacter sp. PRwf-1 AGTACCAGTATCAGTATCAGTATCAGTGCCAGTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1286931-1288022	Sequence	PsycPRwf_1067 - hypothetical protein (Protein is coded in complementary strand; from 1288022 to 1286931)