Sequence retrieval

Genome: Psychrobacter sp. PRwf-1
Start position: 2425165
End position: 2425209
Length: 45

DNA sequence
>NC_009524, from 2425165 to 2425209 (45 bp); Psychrobacter sp. PRwf-1 TTTCAGTATCCGGGTTTTCAGTATCCGGGTTTTCAGTATCCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2424243-2425718	Sequence	PsycPRwf_1946 - hypothetical protein (Protein is coded in complementary strand; from 2425718 to 2424243)