Sequence retrieval

Genome: Psychrobacter sp. PRwf-1
Start position: 2879349
End position: 2879390
Length: 42

DNA sequence
>NC_009524, from 2879349 to 2879390 (42 bp); Psychrobacter sp. PRwf-1 ATGCCAAAAACTAAATGCCAAAAAGTAAATGCCAAAAACTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2879388-2880266	Sequence	PsycPRwf_2312 - hypothetical protein (Protein is coded in complementary strand; from 2880266 to 2879388)