Sequence retrieval

Genome: Psychrobacter sp. PRwf-1
Start position: 2888734
End position: 2888757
Length: 24

DNA sequence
>NC_009524, from 2888734 to 2888757 (24 bp); Psychrobacter sp. PRwf-1 CTGATACTGATACTGATACTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2888170-2888934	Sequence	PsycPRwf_2321 - twin-arginine translocation protein subunit TatB