Sequence retrieval

Genome: Psychrobacter sp. PRwf-1
Start position: 326216
End position: 326239
Length: 24

DNA sequence
>NC_009524, from 326216 to 326239 (24 bp); Psychrobacter sp. PRwf-1 GCTAAGCAGCTAAGCAGCTAAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 326234-327697	Sequence	PsycPRwf_0274 - phosphomannomutase (Protein is coded in complementary strand; from 327697 to 326234)