Sequence retrieval

Genome: Psychrobacter sp. PRwf-1
Start position: 546741
End position: 546776
Length: 36

DNA sequence
>NC_009524, from 546741 to 546776 (36 bp); Psychrobacter sp. PRwf-1 GTCAGGTGCAAAGTCAGGTGCAAAGTTAGGTGCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 546373-546960	Sequence	PsycPRwf_0462 - hypothetical protein (Protein is coded in complementary strand; from 546960 to 546373)