Sequence retrieval

Genome: Psychrobacter sp. PRwf-1
Start position: 662709
End position: 662753
Length: 45

DNA sequence
>NC_009524, from 662709 to 662753 (45 bp); Psychrobacter sp. PRwf-1 AAGCATTTAATACATGGCCATTTAATACATCACCATTTAATACAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 661247-663292	Sequence	PsycPRwf_0554 - signal-transduction protein (Protein is coded in complementary strand; from 663292 to 661247)