Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 110318
End position: 110341
Length: 24

DNA sequence
>NC_009613, from 110318 to 110341 (24 bp); Flavobacterium psychrophilum JIP02/86 TTGCTTTGGCTTTTGTTTTGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 109411-111471	Sequence	FP0086 pepO M13 family metallopeptidase PepO (Protein is coded in complementary strand; from 111471 to 109411)