Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 1264956
End position: 1264985
Length: 30

DNA sequence
>NC_009613, from 1264956 to 1264985 (30 bp); Flavobacterium psychrophilum JIP02/86 ATATTGAAAAATATTCAATAATACCGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1264549-1265016	Sequence	FP1097 - hypothetical protein (Protein is coded in complementary strand; from 1265016 to 1264549)