Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 1306739
End position: 1306766
Length: 28

DNA sequence
>NC_009613, from 1306739 to 1306766 (28 bp); Flavobacterium psychrophilum JIP02/86 CATTTCAGATTTCAGATTTCAGATTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1305567-1306742	Sequence	FP1134 - sugar phosphate nucleotydyl transferase (Protein is coded in complementary strand; from 1306742 to 1305567)