Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 1429656
End position: 1429688
Length: 33

DNA sequence
>NC_009613, from 1429656 to 1429688 (33 bp); Flavobacterium psychrophilum JIP02/86 AAAAAAAGCAATAAAAAGGCAATAAAAAAGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1428942-1429757	Sequence	FP1238 yegX hypothetical protein (Protein is coded in complementary strand; from 1429757 to 1428942)