Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 1705977
End position: 1706012
Length: 36

DNA sequence
>NC_009613, from 1705977 to 1706012 (36 bp); Flavobacterium psychrophilum JIP02/86 ATAACACCTCCTGCAACACCTCCTATAACACCACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1705512-1706207	Sequence	FP1507 yiaD lipoprotein YiaD (Protein is coded in complementary strand; from 1706207 to 1705512)