Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 1749640
End position: 1749663
Length: 24

DNA sequence
>NC_009613, from 1749640 to 1749663 (24 bp); Flavobacterium psychrophilum JIP02/86 TTATTTCTATTTTAATTTTTGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1749219-1750076	Sequence	FP1534 - hypothetical protein (Protein is coded in complementary strand; from 1750076 to 1749219)