Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 1833498
End position: 1833530
Length: 33

DNA sequence
>NC_009613, from 1833498 to 1833530 (33 bp); Flavobacterium psychrophilum JIP02/86 TAATTTTATTTTCATTGTATTTTATTTTTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1832512-1833513	Sequence	FP1613 gapA3 glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) (Protein is coded in complementary strand; from 1833513 to 1832512)