Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 1835744
End position: 1835771
Length: 28

DNA sequence
>NC_009613, from 1835744 to 1835771 (28 bp); Flavobacterium psychrophilum JIP02/86 TGTTTTTTGTTTTTTATTTTTTGTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1834632-1839158	Sequence	FP1615 - hypothetical protein (Protein is coded in complementary strand; from 1839158 to 1834632)