Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 2030659
End position: 2030688
Length: 30

DNA sequence
>NC_009613, from 2030659 to 2030688 (30 bp); Flavobacterium psychrophilum JIP02/86 TTTTGTGCTGTCTTTTGCTGTTTTGTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2028578-2030740	Sequence	FP1785 - TonB-dependent outer membrane receptorprecursor (Protein is coded in complementary strand; from 2030740 to 2028578)