Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 2068005
End position: 2068034
Length: 30

DNA sequence
>NC_009613, from 2068005 to 2068034 (30 bp); Flavobacterium psychrophilum JIP02/86 GGTTTGTTTTTGCTTGTTTTGGTTTTTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2067589-2068641	Sequence	FP1822 pyrD dihydroorotate dehydrogenase 2 (Protein is coded in complementary strand; from 2068641 to 2067589)