Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 2293796
End position: 2293825
Length: 30

DNA sequence
>NC_009613, from 2293796 to 2293825 (30 bp); Flavobacterium psychrophilum JIP02/86 TCATTTTTATTTATTTTTTTTAATTATTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2293165-2293800	Sequence	FP2029 cynT carbonic anhydrase (Protein is coded in complementary strand; from 2293800 to 2293165)
ORF... 2293823-2295307	Sequence	FP2030 sulP sulfate permease (Protein is coded in complementary strand; from 2295307 to 2293823)