Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 2336325
End position: 2336348
Length: 24

DNA sequence
>NC_009613, from 2336325 to 2336348 (24 bp); Flavobacterium psychrophilum JIP02/86 TTTTTGTTCTTGTTTTTGTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2335684-2337669	Sequence	FP2072 dnaG DNA primase (Protein is coded in complementary strand; from 2337669 to 2335684)