Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 2438327
End position: 2438351
Length: 25

DNA sequence
>NC_009613, from 2438327 to 2438351 (25 bp); Flavobacterium psychrophilum JIP02/86 TTGTTTTTTTTCGTTTTGCTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2438104-2438565	Sequence	FP2156 - transporter (Protein is coded in complementary strand; from 2438565 to 2438104)