Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 2592928
End position: 2592951
Length: 24

DNA sequence
>NC_009613, from 2592928 to 2592951 (24 bp); Flavobacterium psychrophilum JIP02/86 AAGCAAAAAAACAAAAAAACAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2589348-2593031	Sequence	FP2256 - bifunctional exporter/1-acyl-sn-glycerol-3-phosphate acyltransferase (Protein is coded in complementary strand; from 2593031 to 2589348)