Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 2599982
End position: 2600009
Length: 28

DNA sequence
>NC_009613, from 2599982 to 2600009 (28 bp); Flavobacterium psychrophilum JIP02/86 TTTAGATTTTAGAATTCAGATTTTAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2598777-2599982	Sequence	FP2265 - 3-oxoacyl-ACP synthase (Protein is coded in complementary strand; from 2599982 to 2598777)