Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 2619079
End position: 2619105
Length: 27

DNA sequence
>NC_009613, from 2619079 to 2619105 (27 bp); Flavobacterium psychrophilum JIP02/86 GTGCTAAATGTGCTAATTGTACTAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2618010-2619530	Sequence	FP2287 hutH2 histidine ammonia-lyase (Protein is coded in complementary strand; from 2619530 to 2618010)