Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 2788302
End position: 2788325
Length: 24

DNA sequence
>NC_009613, from 2788302 to 2788325 (24 bp); Flavobacterium psychrophilum JIP02/86 GCTTTTGCATTTGCGTTTACTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2787252-2789357	Sequence	FP2430 - hypothetical protein (Protein is coded in complementary strand; from 2789357 to 2787252)