Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 2807465
End position: 2807488
Length: 24

DNA sequence
>NC_009613, from 2807465 to 2807488 (24 bp); Flavobacterium psychrophilum JIP02/86 TTATTTTCATTTTTATTTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2806465-2807475	Sequence	FP2449 - sugar phosphate nucleotydyl transferase (Protein is coded in complementary strand; from 2807475 to 2806465)